View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17487_low_34 (Length: 223)
Name: NF17487_low_34
Description: NF17487
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17487_low_34 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 36559791 - 36560004
Alignment:
| Q |
1 |
tagcattattcatgttatattatttgacacatactagtcaaattttggagccccagaaaagttatcttgaaagtttagataaaaaagtaaatatttaatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
36559791 |
tagcattattcatgttatattatttgacacatactagtcaaattttggagccccagaaaagttatcttaaaagtttagataaaaaagtaaatatttaatt |
36559890 |
T |
|
| Q |
101 |
agaaaaaggaatttgattaatttagatgttatgagatggcagaagatactatatttgtctctttcgtaaaagtaaatcacacataaatccgagcttcttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||| ||||||||||| |
|
|
| T |
36559891 |
agaaaaaggaatttgattaatttagatgttatgagatggcagaagatactatatttgtctctttcgtaagagtaaatcccacataaattcgagcttcttt |
36559990 |
T |
|
| Q |
201 |
tgtctctccaacaa |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
36559991 |
tgtctctccaacaa |
36560004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University