View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17487_low_35 (Length: 211)
Name: NF17487_low_35
Description: NF17487
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17487_low_35 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 13 - 198
Target Start/End: Complemental strand, 32332005 - 32331821
Alignment:
| Q |
13 |
aaaaatgatttcaattttacgttgaatgtgtttgcacaaatgcacttcgcgtatttgatttggatttttggactctatagagccaactgagggaggttta |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
32332005 |
aaaaatgatttcaattttacgttgaatgtgtt-gcacaaatgcacttcgcgtatttgatttggatttttggactctaaagagccaattgagggaggttta |
32331907 |
T |
 |
| Q |
113 |
tttggtagtttgaacatactctaatcctaaagtaaccactcgtttggaagctttgtggaatcaagatttccaagctaagattttct |
198 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32331906 |
tttggtagtttgaacataatctaatcctaaagtaaccactcttttggaagctttgtggaatcaagatttccaagctaagattttct |
32331821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University