View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17488_high_10 (Length: 324)
Name: NF17488_high_10
Description: NF17488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17488_high_10 |
 |  |
|
| [»] scaffold0224 (3 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0224 (Bit Score: 127; Significance: 1e-65; HSPs: 3)
Name: scaffold0224
Description:
Target: scaffold0224; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 23 - 149
Target Start/End: Original strand, 6054 - 6180
Alignment:
| Q |
23 |
atagaatttgatatgagcacagaaagtgaaggggtggtcccacaaaaggctgaagggcataatgtccttttgtaagcttttgagctgctttgaccgtatg |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6054 |
atagaatttgatatgagcacagaaagtgaaggggtggtcccacaaaaggctgaagggcataatgtccttttgtaagcttttgagctgctttgaccgtatg |
6153 |
T |
 |
| Q |
123 |
tataccatattccctgaaaaccaattg |
149 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
6154 |
tataccatattccctgaaaaccaattg |
6180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0224; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 202 - 238
Target Start/End: Original strand, 6223 - 6259
Alignment:
| Q |
202 |
gcatagcatagcatatgagagaagagatgagattccc |
238 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |
|
|
| T |
6223 |
gcatagaatagcatatgagagaagagatgagattccc |
6259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0224; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 174 - 206
Target Start/End: Original strand, 6205 - 6237
Alignment:
| Q |
174 |
gtggtccaattcatttttgcatagaatagcata |
206 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
6205 |
gtggtccaattcctttttgcatagaatagcata |
6237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 127; Significance: 1e-65; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 23 - 149
Target Start/End: Original strand, 42902081 - 42902207
Alignment:
| Q |
23 |
atagaatttgatatgagcacagaaagtgaaggggtggtcccacaaaaggctgaagggcataatgtccttttgtaagcttttgagctgctttgaccgtatg |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42902081 |
atagaatttgatatgagcacagaaagtgaaggggtggtcccacaaaaggctgaagggcataatgtccttttgtaagcttttgagctgctttgaccgtatg |
42902180 |
T |
 |
| Q |
123 |
tataccatattccctgaaaaccaattg |
149 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
42902181 |
tataccatattccctgaaaaccaattg |
42902207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 202 - 238
Target Start/End: Original strand, 42902250 - 42902286
Alignment:
| Q |
202 |
gcatagcatagcatatgagagaagagatgagattccc |
238 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |
|
|
| T |
42902250 |
gcatagaatagcatatgagagaagagatgagattccc |
42902286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 174 - 206
Target Start/End: Original strand, 42902232 - 42902264
Alignment:
| Q |
174 |
gtggtccaattcatttttgcatagaatagcata |
206 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
42902232 |
gtggtccaattcctttttgcatagaatagcata |
42902264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University