View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17488_low_14 (Length: 255)
Name: NF17488_low_14
Description: NF17488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17488_low_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 119; Significance: 7e-61; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 1 - 127
Target Start/End: Original strand, 365794 - 365920
Alignment:
| Q |
1 |
atgctttatatctagagaattttgcctataggtggttctgcgtatgttgaaatcatccatataatacaacccaccttttttagtacaatgactaatgatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
365794 |
atgctttatatctagagaattttgcctatagttggttctgcgtatgttgaaatcatccatataatacaacccaccttttttagtacaatgactaatgatt |
365893 |
T |
|
| Q |
101 |
ttcttggtgagaatatcatgaagaaaa |
127 |
Q |
| |
|
| ||||||||||||||||||||||||| |
|
|
| T |
365894 |
tccttggtgagaatatcatgaagaaaa |
365920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 134 - 238
Target Start/End: Original strand, 369435 - 369539
Alignment:
| Q |
134 |
tggccaataggcgctaatttgtttgacaaagatggaacaagtcaagtgtgacaatgaaatagaatgtgaaagagcaacagttgcagcttttgtaactgca |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
369435 |
tggccaataggcgctaatttgtttgacaaagatggaacaagtcaagtgtgacaatgaaatagaatgtgaaagagcaacagttgcagcttttgtaactgca |
369534 |
T |
|
| Q |
234 |
tatat |
238 |
Q |
| |
|
||||| |
|
|
| T |
369535 |
tatat |
369539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University