View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17488_low_23 (Length: 201)
Name: NF17488_low_23
Description: NF17488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17488_low_23 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 81; Significance: 2e-38; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 81; E-Value: 2e-38
Query Start/End: Original strand, 1 - 85
Target Start/End: Original strand, 45254018 - 45254102
Alignment:
| Q |
1 |
ggtttttcctactgaaggaaatataattgattgcattcgttatggtgatcccaaatatgagacacttgatattaggaaaggtttg |
85 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45254018 |
ggtttttcctactgaaggaaatataattcattgcattcgttatggtgatcccaaatatgagacacttgatattaggaaaggtttg |
45254102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 1 - 84
Target Start/End: Complemental strand, 44261621 - 44261538
Alignment:
| Q |
1 |
ggtttttcctactgaaggaaatataattgattgcattcgttatggtgatcccaaatatgagacacttgatattaggaaaggttt |
84 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
44261621 |
ggtttttcctatcgaaggaaatataattgattgcattcgttatggtgatcccaaatatgagacagttgatattaggaagggttt |
44261538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University