View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17489_low_4 (Length: 249)
Name: NF17489_low_4
Description: NF17489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17489_low_4 |
 | |
|
| [»] scaffold1667 (1 HSPs) |
| | |
|
| [»] scaffold0044 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 66; Significance: 3e-29; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 70
Target Start/End: Original strand, 34944636 - 34944705
Alignment:
| Q |
1 |
ttattattagaaacaaatttaaattttcttatattaaaactcagagttatgttgatcatttcatcgttaa |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34944636 |
ttattattagaaacaaatttaaattttcttatattaaaactcagagttatgttgatcatttcatccttaa |
34944705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1667 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold1667
Description:
Target: scaffold1667; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 232
Target Start/End: Complemental strand, 776 - 720
Alignment:
| Q |
176 |
tggcggcggaggatgaaggtttttcgaggtgccaatctagttgggacgtcgttgctt |
232 |
Q |
| |
|
||||||| |||||| ||||| ||||||||||||| ||||| |||| |||||||||| |
|
|
| T |
776 |
tggcggcataggatggaggttcttcgaggtgccaacctagtcgggatgtcgttgctt |
720 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0044 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0044
Description:
Target: scaffold0044; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 232
Target Start/End: Original strand, 20863 - 20919
Alignment:
| Q |
176 |
tggcggcggaggatgaaggtttttcgaggtgccaatctagttgggacgtcgttgctt |
232 |
Q |
| |
|
||||||| |||||| ||||| ||||||||||||| ||||| |||| |||||||||| |
|
|
| T |
20863 |
tggcggcataggatggaggttcttcgaggtgccaacctagtcgggatgtcgttgctt |
20919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University