View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17489_low_4 (Length: 249)

Name: NF17489_low_4
Description: NF17489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17489_low_4
NF17489_low_4
[»] chr1 (1 HSPs)
chr1 (1-70)||(34944636-34944705)
[»] scaffold1667 (1 HSPs)
scaffold1667 (176-232)||(720-776)
[»] scaffold0044 (1 HSPs)
scaffold0044 (176-232)||(20863-20919)


Alignment Details
Target: chr1 (Bit Score: 66; Significance: 3e-29; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 70
Target Start/End: Original strand, 34944636 - 34944705
Alignment:
1 ttattattagaaacaaatttaaattttcttatattaaaactcagagttatgttgatcatttcatcgttaa 70  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
34944636 ttattattagaaacaaatttaaattttcttatattaaaactcagagttatgttgatcatttcatccttaa 34944705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1667 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold1667
Description:

Target: scaffold1667; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 232
Target Start/End: Complemental strand, 776 - 720
Alignment:
176 tggcggcggaggatgaaggtttttcgaggtgccaatctagttgggacgtcgttgctt 232  Q
    |||||||  |||||| ||||| ||||||||||||| ||||| |||| ||||||||||    
776 tggcggcataggatggaggttcttcgaggtgccaacctagtcgggatgtcgttgctt 720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0044 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0044
Description:

Target: scaffold0044; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 232
Target Start/End: Original strand, 20863 - 20919
Alignment:
176 tggcggcggaggatgaaggtttttcgaggtgccaatctagttgggacgtcgttgctt 232  Q
    |||||||  |||||| ||||| ||||||||||||| ||||| |||| ||||||||||    
20863 tggcggcataggatggaggttcttcgaggtgccaacctagtcgggatgtcgttgctt 20919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University