View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17489_low_5 (Length: 247)

Name: NF17489_low_5
Description: NF17489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17489_low_5
NF17489_low_5
[»] chr1 (1 HSPs)
chr1 (154-247)||(34944533-34944626)


Alignment Details
Target: chr1 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 154 - 247
Target Start/End: Original strand, 34944533 - 34944626
Alignment:
154 caaaaactatatggaattggtgatagtggccgggcccgaagcaaagagctagcacgacatgactccatttttatttgggttaaaaacaaataat 247  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34944533 caaaaactatatggaattgttgatagtggccgggcccgaagcaaagagctagcacgacatgactccatttttatttgggttaaaaacaaataat 34944626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University