View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1748_high_20 (Length: 242)
Name: NF1748_high_20
Description: NF1748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1748_high_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 27568666 - 27568462
Alignment:
| Q |
1 |
aagaattgaccaagccttttaagggttgatttgttcatatccctagttaacgcgggatatctggacaccgcttctcgcataggaattgagttgacattgg |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27568666 |
aagaattgaccaagccttttaaggattgatttgttcatatctctagttaacgcgagatatctggacaccgcttctcgcataggaattgagttgacattgg |
27568567 |
T |
 |
| Q |
101 |
aagagtgtacaaatgtgggtcgcccaataacagagaaattaacaattcctgttattgaaaccaccttgatg--attatagtgtatctaaacttatttccc |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||| |||||||| |
|
|
| T |
27568566 |
aagagtgtacaaatgtgggtcgcccaataacagagaaattaacaattcctgttattgaaaccaccttgatgaaattatattgtatctaaatttatttcct |
27568467 |
T |
 |
| Q |
199 |
cattc |
203 |
Q |
| |
|
||||| |
|
|
| T |
27568466 |
cattc |
27568462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University