View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1748_low_18 (Length: 288)
Name: NF1748_low_18
Description: NF1748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1748_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 50; Significance: 1e-19; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 141 - 190
Target Start/End: Original strand, 12678205 - 12678254
Alignment:
| Q |
141 |
cttgcaaatgcacgtctatatatttgtaatcaatttactatgattattgt |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12678205 |
cttgcaaatgcacgtctatatatttgtaatcaatttactatgattattgt |
12678254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 202 - 253
Target Start/End: Original strand, 12678238 - 12678289
Alignment:
| Q |
202 |
tttactatgattattgtcatgcattcttttgtccggtgttgtttttcttcac |
253 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
12678238 |
tttactatgattattgttatgcattcttttgtccggtgttgtttttcttcac |
12678289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University