View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1748_low_32 (Length: 209)
Name: NF1748_low_32
Description: NF1748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1748_low_32 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 19 - 193
Target Start/End: Complemental strand, 7721012 - 7720838
Alignment:
| Q |
19 |
atgataatgatcagggtgccaaaataattgtgatggcttgcatggatgtgttttcccaaaactgcaatgacttactgtaattcttccaaattcaccatta |
118 |
Q |
| |
|
|||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7721012 |
atgatagtgatgagggtgccaaaataattgtgatggcttgcatggatgtgttttcccaaaactgcaatgacttactgtaattcttccaaattcaccatta |
7720913 |
T |
 |
| Q |
119 |
gtcacataacatgcatgaaaaaatatttgtgtttgcaacacacatgattaacgagagtgtgggatatgccaaatt |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7720912 |
gtcacataacatgcatgaaaaaatatttgtgtttgcaacacacatgattaacgagagtgtgggatatgccaaatt |
7720838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University