View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1748_low_33 (Length: 203)
Name: NF1748_low_33
Description: NF1748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1748_low_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 16 - 189
Target Start/End: Original strand, 26735216 - 26735389
Alignment:
| Q |
16 |
catttttaatgtttcgcataataacatatctgggaaaatccctgatgagattagattcatgacgagtctaacgacgctggatttatcttacaacaatttt |
115 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26735216 |
catttttaatgtttcgcataatagcatatctgggaaaatccctgatgagattagattcatgacgagtctaacgacgctggatttatcttacaacaatttt |
26735315 |
T |
 |
| Q |
116 |
accggaattgtccccacaggtggtcagtttttggtcttcaacgaccggtcatttgccggaaatcctagcctatg |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26735316 |
accggaattgtccccacaggtggtcagtttttggtcttcaacgaccggtcatttgccggaaatcctagcctatg |
26735389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 16 - 189
Target Start/End: Original strand, 26726902 - 26727075
Alignment:
| Q |
16 |
catttttaatgtttcgcataataacatatctgggaaaatccctgatgagattagattcatgacgagtctaacgacgctggatttatcttacaacaatttt |
115 |
Q |
| |
|
|||||| |||||||||||||||| |||||| ||| ||||||| |||| ||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
26726902 |
cattttgaatgtttcgcataatagcatatcggggcaaatccccaatgatattagattcatgatgagtctaacgacgctggatttatcttacaacaatttc |
26727001 |
T |
 |
| Q |
116 |
accggaattgtccccacaggtggtcagtttttggtcttcaacgaccggtcatttgccggaaatcctagcctatg |
189 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||| |||||||| ||||| |||||| |||| |
|
|
| T |
26727002 |
accggaattgtccccaccggtggtcagtttttggtcttcaacgaccgttcatttgcgggaaaccctagcttatg |
26727075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University