View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17491_high_8 (Length: 262)
Name: NF17491_high_8
Description: NF17491
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17491_high_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 19 - 257
Target Start/End: Original strand, 52030740 - 52030978
Alignment:
| Q |
19 |
gattcatggctaaggtgcttcctacaaaaaagtttcggatcattggttttggagagagagagttttcgttaaatccgggtccttttaacgtgaaagaaca |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
52030740 |
gattcatggctaaggtgcttcctacaaaaaagtttcggatcattggttttggagagagagagttttcgttaaatccgggtccttttaacgtgaaagagca |
52030839 |
T |
|
| Q |
119 |
cgtgcttatttccatgtttgcaaatgctggtgctgcgtttgggagtggcactgcttatgctctcagtattgttgatatcattcgtgtattttattacagg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52030840 |
cgtgcttatttccatgtttgcaaatgctggtgctgcgtttgggagtggcactgcttatgctctcagtattgttgatatcattcgtgtattttattacagg |
52030939 |
T |
|
| Q |
219 |
aagattacctttcttaccagttggattcttcttctcact |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
52030940 |
aagattacctttcttaccagttggattcttgttctcact |
52030978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 80 - 161
Target Start/End: Original strand, 36900259 - 36900340
Alignment:
| Q |
80 |
gttttcgttaaatccgggtccttttaacgtgaaagaacacgtgcttatttccatgtttgcaaatgctggtgctgcgtttggg |
161 |
Q |
| |
|
||||||||| || || ||||| |||||| |||| ||||| || |||||| |||| |||||||||||||| |||||||||||| |
|
|
| T |
36900259 |
gttttcgtttaacccaggtccgtttaacatgaaggaacatgttcttattaccatatttgcaaatgctggggctgcgtttggg |
36900340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University