View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17491_low_11 (Length: 205)
Name: NF17491_low_11
Description: NF17491
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17491_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 2e-88; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 20 - 188
Target Start/End: Original strand, 44776643 - 44776811
Alignment:
| Q |
20 |
ataagttgatacaggaaagcggtggttgtgatgatgatgatgataaccttgttgttgtttataataaaggaactgaaattcactgtagagttatcaaaat |
119 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44776643 |
ataagttgatacaggaaagcggtagttgtgatgatgatgatgataaccttgttgttgtttataataaaggaactgaaattcactgtagagttatcaaaat |
44776742 |
T |
|
| Q |
120 |
aggatttcaaaatgacccctctgttcaaaattctttgctttatttctattcacaatgtgggttggtctc |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44776743 |
aggatttcaaaatgacccctctgttcaaaattctttgctttatttctattcacaatgtgggttggtctc |
44776811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 20 - 188
Target Start/End: Complemental strand, 28369869 - 28369707
Alignment:
| Q |
20 |
ataagttgatacaggaaagcggtggttgtgatgatgatgatgataaccttgttgttgtttataataaaggaactgaaattcactgtagagttatcaaaat |
119 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28369869 |
ataagttgatacaggaaagcggtagttgtgatgatgat------aaccttgttgttgtttataataaaggaactgaaattcactgtagagttatcaaaat |
28369776 |
T |
|
| Q |
120 |
aggatttcaaaatgacccctctgttcaaaattctttgctttatttctattcacaatgtgggttggtctc |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28369775 |
aggatttcaaaatgacccctctgttcaaaattctttgctttatttctattcacaatgtgggttggtctc |
28369707 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University