View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17491_low_5 (Length: 332)
Name: NF17491_low_5
Description: NF17491
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17491_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 285; Significance: 1e-160; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 19 - 324
Target Start/End: Original strand, 32177571 - 32177878
Alignment:
| Q |
19 |
ggactcgaaggaaaaaagggtcaacggagatggaagaagaaggtggtggaggtggaaggttaaatgggacacggttaacttgagggaaacaagagtgaaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32177571 |
ggactcgaaggaaaaaagggtcaacggagatggaagaagaaggtggtggaggtggaaggttaaatgggacacggttaacttgagggaaacaagagtgaaa |
32177670 |
T |
 |
| Q |
119 |
gtgatcaaggagttgtgattctgcaagagaaacagtgggaagaggagtgatgagagtgactttgcaattgttgttgagaaacaatgatgctagtcttagg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32177671 |
gtgatcaaggagttgtgattctgcaagagaaacagtgggaagaggagtgatgagagtgactttgcaattgttgttgagaaacaatgatgctagtcttagg |
32177770 |
T |
 |
| Q |
219 |
aatggtgtgagatgacccattcctgcacttgggaacatggcaacatgaacagtttcatcagac--attgcttatggttatgattactaatggcttcctat |
316 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
32177771 |
aatggtgtgagatgacccattccagcacttgggaacatggcaacatgaacaacttcatcagacatattgcttatggttatgattactaatggcttcctat |
32177870 |
T |
 |
| Q |
317 |
aggagggt |
324 |
Q |
| |
|
|||||||| |
|
|
| T |
32177871 |
aggagggt |
32177878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 96 - 287
Target Start/End: Original strand, 32184809 - 32185000
Alignment:
| Q |
96 |
acttgagggaaacaagagtgaaagtgatcaaggagttgtgattctgcaagagaaacagtgggaagaggagtgatgagagtgactttgcaattgttgttga |
195 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| || || |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
32184809 |
acttgagggaaagaagagtgaaagtgatcaagaagctgggattctgcaagagagacagtgggaagaggagtgatgagagtgactttgcaattgttgttaa |
32184908 |
T |
 |
| Q |
196 |
gaaacaatgatgctagtcttaggaatggtgtgagatgacccattcctgcacttgggaacatggcaacatgaacagtttcatcagacattgct |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
32184909 |
gaaacaatgatgctagtcttaggaatggtgtgagatgacccattccagcacttggaaacatggcaacatgaacaacttcatcagacattgct |
32185000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University