View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17492_high_14 (Length: 280)
Name: NF17492_high_14
Description: NF17492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17492_high_14 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 18 - 268
Target Start/End: Complemental strand, 25416316 - 25416066
Alignment:
| Q |
18 |
acataagagcgcgggaaaagcaagaatctttggcaccaaaagacgttactataaataagtttgtgtgtataccgatcggaagttgaaaaagagaggaaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25416316 |
acataagagcgcgggaaaagcaagaatctttggcaccaaaagacgttactataaataagtttgtgtgtataccgatcggaagttgaaaaagagaggaaaa |
25416217 |
T |
 |
| Q |
118 |
agatgcagattcgtatacagtgcaattgtgaggaaggaaactgtgtggaatggggcattgttgaactgcaaggagttgttgaaccacaacctggttttca |
217 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
25416216 |
agatgcagattcgtgtacagtgcaattgtgaggaaggaaactgtgtggaatggggcattgttgaactgcaaggagttgttgaaccacagcctggttttca |
25416117 |
T |
 |
| Q |
218 |
ggattcccttgccaaccttcaaattggcactctctgtcgtccttcatctca |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
25416116 |
ggattcccttgccaaccttcaaattggcactctctgccgtccttcttctca |
25416066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University