View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17492_high_17 (Length: 224)

Name: NF17492_high_17
Description: NF17492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17492_high_17
NF17492_high_17
[»] chr3 (1 HSPs)
chr3 (11-224)||(32861108-32861321)


Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 11 - 224
Target Start/End: Complemental strand, 32861321 - 32861108
Alignment:
11 gaagaatatcgcagagaaagggaacactgaaaatttatatgttggggcggatgacccgaggttaagcagaatatgagtttgggtatcatttaattaacgg 110  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32861321 gaagaaaatcgcagagaaagggaacactgaaaatttatatgttggggcggatgacccgaggttaagcagaatatgagtttgggtatcatttaattaacgg 32861222  T
111 gttaggataggggtccattccggaactatcgggtcggatcaagtccgagtaaaatataaataaagtggagataccgataaacgagtgaagtgaagacgga 210  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32861221 gttaggataggggtccattccggaactatcgggtcggatcaagtccgagtaaaatataaataaagtggagataccgataaacgagtgaagtgaagacgga 32861122  T
211 aatggaggaattgc 224  Q
    ||||||||||||||    
32861121 aatggaggaattgc 32861108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University