View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17492_low_15 (Length: 267)

Name: NF17492_low_15
Description: NF17492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17492_low_15
NF17492_low_15
[»] chr2 (1 HSPs)
chr2 (16-259)||(5333541-5333784)


Alignment Details
Target: chr2 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 16 - 259
Target Start/End: Complemental strand, 5333784 - 5333541
Alignment:
16 gtggtggtttttacagctgcgttgaaggagtatgcgagtttggttgtggaccggctggaccggaatgggtttatttcgcatcggctttatagggattcgt 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5333784 gtggtggtttttacagctgcgttgaaggagtatgcgagtttggttgtggaccggctggaccggaatgggtttatttcgcatcggctttatagggattcgt 5333685  T
116 gtaggaatgttgatgggaagcttgtgaaagatttgggttttgtgggaagagatttgaagaaggttgttattgttgatgataatccagtttcgttttcgaa 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5333684 gtaggaatgttgatgggaagcttgtgaaagatttgggttttgtgggaagagatttgaagaaggttgttattgttgatgataatccagtttcgttttcgaa 5333585  T
216 tcaacctgcgaatgcaattttgattaagccttttgttgatgatg 259  Q
    ||||||||| ||||| ||||||||||||||||||||||||||||    
5333584 tcaacctgcaaatgcgattttgattaagccttttgttgatgatg 5333541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University