View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17492_low_15 (Length: 267)
Name: NF17492_low_15
Description: NF17492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17492_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 16 - 259
Target Start/End: Complemental strand, 5333784 - 5333541
Alignment:
| Q |
16 |
gtggtggtttttacagctgcgttgaaggagtatgcgagtttggttgtggaccggctggaccggaatgggtttatttcgcatcggctttatagggattcgt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5333784 |
gtggtggtttttacagctgcgttgaaggagtatgcgagtttggttgtggaccggctggaccggaatgggtttatttcgcatcggctttatagggattcgt |
5333685 |
T |
 |
| Q |
116 |
gtaggaatgttgatgggaagcttgtgaaagatttgggttttgtgggaagagatttgaagaaggttgttattgttgatgataatccagtttcgttttcgaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5333684 |
gtaggaatgttgatgggaagcttgtgaaagatttgggttttgtgggaagagatttgaagaaggttgttattgttgatgataatccagtttcgttttcgaa |
5333585 |
T |
 |
| Q |
216 |
tcaacctgcgaatgcaattttgattaagccttttgttgatgatg |
259 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
5333584 |
tcaacctgcaaatgcgattttgattaagccttttgttgatgatg |
5333541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University