View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17492_low_18 (Length: 224)
Name: NF17492_low_18
Description: NF17492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17492_low_18 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 11 - 224
Target Start/End: Complemental strand, 32861321 - 32861108
Alignment:
| Q |
11 |
gaagaatatcgcagagaaagggaacactgaaaatttatatgttggggcggatgacccgaggttaagcagaatatgagtttgggtatcatttaattaacgg |
110 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32861321 |
gaagaaaatcgcagagaaagggaacactgaaaatttatatgttggggcggatgacccgaggttaagcagaatatgagtttgggtatcatttaattaacgg |
32861222 |
T |
 |
| Q |
111 |
gttaggataggggtccattccggaactatcgggtcggatcaagtccgagtaaaatataaataaagtggagataccgataaacgagtgaagtgaagacgga |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32861221 |
gttaggataggggtccattccggaactatcgggtcggatcaagtccgagtaaaatataaataaagtggagataccgataaacgagtgaagtgaagacgga |
32861122 |
T |
 |
| Q |
211 |
aatggaggaattgc |
224 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
32861121 |
aatggaggaattgc |
32861108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University