View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17492_low_19 (Length: 216)
Name: NF17492_low_19
Description: NF17492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17492_low_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 14 - 210
Target Start/End: Original strand, 30710789 - 30710988
Alignment:
| Q |
14 |
attattctacaagtggttctagttgcttttctggtatttctatggagtttccgttgctacaccagatataggaggaggcgttcccgctgaattaaaagag |
113 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30710789 |
attattctacaagtggttgtagttgcttttctggtatttctatggagtttccgttgctacaccagatataggaggaggcgttcccgctgaattaaaagag |
30710888 |
T |
|
| Q |
114 |
accttggtgtttacatgattttgaactgtggtaatattttaaatatattcttcattctccctttgtcagttctacttg---attgtgaattgatgatgtc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||| ||| ||||||||||||||| |
|
|
| T |
30710889 |
accttggtgtttacatgattttgaactgtggtaatattttaaatatattcttcattctccctttctcagttcttcttgattattatgaattgatgatgtc |
30710988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University