View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17492_low_20 (Length: 204)
Name: NF17492_low_20
Description: NF17492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17492_low_20 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 18 - 186
Target Start/End: Original strand, 43244026 - 43244194
Alignment:
| Q |
18 |
aatagcgtgcaaacgacgaaaccctagagtctctgttcgtcgcacaaggggtattaatgttgcagctattggttttcctcttggaatgtcggtcgccgct |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43244026 |
aatagcgtgcaaacgacgaaaccctagagtctctgttcgtcgcacaaggggtaataatgttgcagctattggttttcctcttggaatgtcggtcgccgct |
43244125 |
T |
|
| Q |
118 |
gttatggctcaggtaaacggcaccgttaaagctttaatttttaaagtttattgccttctgatgattatt |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43244126 |
gttatggctcaggtaaacggcaccgttaaagctttaatttttaaagtttattgccttctgatgattatt |
43244194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University