View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17493_low_16 (Length: 300)
Name: NF17493_low_16
Description: NF17493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17493_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 1 - 285
Target Start/End: Original strand, 4570177 - 4570460
Alignment:
| Q |
1 |
tgattgctttgctttgtctgtgttttcagcgttggagatttgagtcactttctcccaccaaacccatagagaaagtagagagtttcacgtggagcatgct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4570177 |
tgattgctttgctttgtctgtgttttcagcgttggagatttgagtcactttctcccaccaaacccatagagaaagtagagagtttcacgtggagcatgct |
4570276 |
T |
 |
| Q |
101 |
gcaccccattccatatctcaccccaaccaacaccattccctcaattaattttgtatattaccatgctgttacaaactttctataaaaagttactaatcta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4570277 |
gcaccccattccatatctcaccccaaccaacaccattccctcaattaattttgtata-taccatgctgttacaaactttctataaaaagttactaatcta |
4570375 |
T |
 |
| Q |
201 |
agaacttattttttgtcgtacagtttatcctctttcagtcaaaagatttcataggaattttttacagccggccaaaaattgcaca |
285 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
4570376 |
agaacttattttttgttgtacagtttatcctctttcagtcaaaagatttcataggaattttatacagcctgccaaaaattgcaca |
4570460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University