View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17493_low_17 (Length: 289)
Name: NF17493_low_17
Description: NF17493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17493_low_17 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 40 - 274
Target Start/End: Original strand, 4057921 - 4058155
Alignment:
| Q |
40 |
gcaaaatgataatcctacccttctagaaacactcaagcttcccaattattattttggttctgatggttgtgttctttgggttttcaggttgcgaatctga |
139 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4057921 |
gcaaaatgataatcttacccttctagaaacactcaagcttcccaattattattttggttctgatggttgtgttctttgggttttcaggttgcgaatctga |
4058020 |
T |
 |
| Q |
140 |
tgcgattagaagggattatgtttggattgagcatgttgatgatggttggggttctgtagtgtattcacataggaaatcttcaaccaatcaaagtatgtat |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4058021 |
tgcgattagaagggattatgtttggattgagcatgttgatgatggttggggtcctgcagtgtattcacagaggaaatcttcaaccaatcaaagtatgtat |
4058120 |
T |
 |
| Q |
240 |
agttacaatcatatctttgcagttttgattactga |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
4058121 |
agttacaatcatatctttgcagttttgattactga |
4058155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University