View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17493_low_32 (Length: 203)
Name: NF17493_low_32
Description: NF17493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17493_low_32 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 13 - 187
Target Start/End: Complemental strand, 32997389 - 32997215
Alignment:
| Q |
13 |
caagaatatgattgaagcttctattgtaatatggaaaaggaagatgaataaagacggaaaatcttcatggagttcagcaataagcatggagaagagagaa |
112 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32997389 |
caagaataggattgaagcttctattgtaatatggaaaaggaagatgaataaagatggaaaatcttcatggagttcagcaataagcatggagaagagagaa |
32997290 |
T |
 |
| Q |
113 |
ctctttgaagagagagcagaaacaatattgttgatgatcaaacaagagtttccaggacttccacagtcttcactt |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32997289 |
ctctttgaagagagagcagaaacaatattgttgatgatcaaacaagagtttccaggacttccacagtcttcactt |
32997215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 99 - 135
Target Start/End: Original strand, 3550007 - 3550043
Alignment:
| Q |
99 |
tggagaagagagaactctttgaagagagagcagaaac |
135 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
3550007 |
tggagaaaagagagctctttgaagagagagcagaaac |
3550043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University