View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17494_high_13 (Length: 257)
Name: NF17494_high_13
Description: NF17494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17494_high_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 19 - 237
Target Start/End: Original strand, 6668489 - 6668706
Alignment:
| Q |
19 |
atgaagaacaaagcttgaatgttctgaaggtggtgtcatgcgataactaacaggtgtagataatgtatgtatctctctgcatcagtttgttgttattttc |
118 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
6668489 |
atgaagaacaa-gcttgaatgctctgaaggtggtgtcatgcgataactaacaggtgtagataatgtatatatctctctgcatcagtttgttgttattttc |
6668587 |
T |
 |
| Q |
119 |
tccataattatcctcttccatgatttacatatttttgttacagctattgttataattctttttccccttcattggtttctcttctgcagtgaaaatcaat |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6668588 |
tccataattatcctcttccatgatttacatattttcgttacagctattgttataattctttttccccttcattggtttctcttctgcagtgaaaatcaat |
6668687 |
T |
 |
| Q |
219 |
ttagttagcaatgcataat |
237 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
6668688 |
ttagttagcaatgcataat |
6668706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University