View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17494_high_5 (Length: 392)
Name: NF17494_high_5
Description: NF17494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17494_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 6e-90; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 6e-90
Query Start/End: Original strand, 74 - 253
Target Start/End: Complemental strand, 34963361 - 34963182
Alignment:
| Q |
74 |
atagttatatgaagcacgcaagcagcaataaaaggaaatggaaagcgtgcaagattagtttaacgaggtagagtgataaacgaaggaaccatagctaact |
173 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
34963361 |
atagttatacgaagcacgcaagcagcaataaaaggaaatggaaagcgtgcaagattagtttaactaggtagagtgataaacgaaggaaccatagctaact |
34963262 |
T |
 |
| Q |
174 |
accttggagagaagagtgttgtggtaggtgacggctcacgtggcagttgtcagcgtagactactaactagatctcgatta |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34963261 |
accttggagagaagagtgttgtggtaggtgacggctcacgtggcagttgtcggcgtagactactaactagatctcgatta |
34963182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 254 - 370
Target Start/End: Complemental strand, 34963151 - 34963035
Alignment:
| Q |
254 |
gtaaactctgaattttttgctgtttacttttggcgccagctctatgtatctatcctatatttggggatggtggttgggtggctaactgtttatcaaattt |
353 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
34963151 |
gtaaactctgaattttttgctgtttacttttggcgccagctctatgtatctatcctacatttggggatggtggttgggtggttaactgtttatcaaattt |
34963052 |
T |
 |
| Q |
354 |
ttacttttattctcttt |
370 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
34963051 |
ttacttttattctcttt |
34963035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 17 - 52
Target Start/End: Complemental strand, 34963414 - 34963379
Alignment:
| Q |
17 |
cggaatttatgaattttattgaataaagacgagttc |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
34963414 |
cggaatttatgaattttattgaataaagacgagttc |
34963379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University