View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17494_high_6 (Length: 335)
Name: NF17494_high_6
Description: NF17494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17494_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 18 - 303
Target Start/End: Original strand, 54505141 - 54505422
Alignment:
| Q |
18 |
gattcttggaagtttcaatcgctatgatgatgttcttaattttctagattatgtttacgtatttgcattgatgtcttttgaattaagctttgtgactaca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54505141 |
gattcttggaagtttcaatcgctatgatgatgttcttaattttctagattatgtttacgtatttgcattgatgtcttttgaattaagctttgtgactaca |
54505240 |
T |
 |
| Q |
118 |
tgcataaatattatgcaatattgtgtgtggggtcaaagtcaagcacattttcattttgctttcatgtttccttaattttcattttcatgtagtagttagt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
54505241 |
tgcataaatattatgcaatattgtgtgtggggtcaaagtcaagcacattttcattttgctttcatgtttccttaattttcattttcatgtag----tagt |
54505336 |
T |
 |
| Q |
218 |
ttcttgtgtggttgattagaatgattaatttcgcccttgaactacaacggttggtcttacttttccttaattttcattttcgtggg |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54505337 |
ttcttgtgtggttgattagaatgattaatttcgcccttgaactacaacggttggtcttacttttccttaattttcattttcgtggg |
54505422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University