View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17494_low_14 (Length: 261)
Name: NF17494_low_14
Description: NF17494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17494_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 13 - 245
Target Start/End: Original strand, 30017898 - 30018130
Alignment:
| Q |
13 |
aaggagattgaaaaagcagtggaagatttaacagctgagttaattgcaacaaaggagtcattgattttgactcaaacggcgcacttggcagccgaggaac |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
30017898 |
aaggagattgaaaaagcagtggaagatttaacagctgagttaattgcaacaaaggagtcattgatttcgactcaaacggcgcacttggcagccgaggaac |
30017997 |
T |
 |
| Q |
113 |
aagcatcgggcatcatcgatgaagaaactcaaaactataagcttgaacttgaacaatcagaaaaggagctagagacactaaatgaacaagttttatcagc |
212 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30017998 |
aagcatcgggcgtcatcgatgaagaaactcaaaactataagcttgaacttgaacaatcagaaaaggagctagagacactaaatgaacaagttttatcagc |
30018097 |
T |
 |
| Q |
213 |
aagagttctcaaatccaaattggaagcatcttc |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
30018098 |
aagagttctcaaatccaaattggaagcatcttc |
30018130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University