View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17494_low_15 (Length: 258)
Name: NF17494_low_15
Description: NF17494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17494_low_15 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 11 - 258
Target Start/End: Original strand, 30017535 - 30017782
Alignment:
| Q |
11 |
cagagaagcaagattggacatgaatttggaaaaccaaatacagctgaagaattggaaaacactaagaaacttacagaagaacttaaactcaacttagaaa |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
30017535 |
cagagaagcaagattggacatgaatttggaaaaccaaatacagctgaagaattggaaaacactaagaaacttacagaagaactcaaactcaacttagaaa |
30017634 |
T |
 |
| Q |
111 |
gtgtagaaagagatgagcttcaggtaaaagaagaagtggaacttgtgattcgaaaaattgaggagctggagcaagaccttgcagatgaagccagttttga |
210 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30017635 |
gtgtagaaagagatgagcttcaggtgaaagaagaagtggaacttgtgattcgaaaaattgaggagctggagcaagaccttgcagatgaagccagttttga |
30017734 |
T |
 |
| Q |
211 |
agccaaagcacaacttgaggttgaaaaatcaatgcatagtgccgcagt |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30017735 |
agccaaagcacaacttgaggttgaaaaatcaatgcatagtgccgcagt |
30017782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University