View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17494_low_21 (Length: 211)
Name: NF17494_low_21
Description: NF17494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17494_low_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 76 - 196
Target Start/End: Complemental strand, 29237879 - 29237758
Alignment:
| Q |
76 |
aaaagtaacgttaggagataacactgtagattgattatataaacactgtggtctgtgggg-aactagttgctacattagggaatgatctgaatagattga |
174 |
Q |
| |
|
||||||||||||||| |||||| |||||| |||||||| |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29237879 |
aaaagtaacgttaggggataacgctgtaggttgattatgtaaaaactgtggtctgtgggggaactagttgctacattagggaatgatctgaatagattga |
29237780 |
T |
|
| Q |
175 |
ctattggaacacttgagataac |
196 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
29237779 |
ctattggaacacttgagataac |
29237758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 17 - 77
Target Start/End: Complemental strand, 29237974 - 29237914
Alignment:
| Q |
17 |
atcaaattccttccaaatctcaatccaaaactcgacgtagcggattgagagtttgtcttaa |
77 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
29237974 |
atcaaattccttccaaatctcaatccaaaactggacatagcggattgagagtttgtcttaa |
29237914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University