View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17494_low_9 (Length: 328)
Name: NF17494_low_9
Description: NF17494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17494_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 55 - 309
Target Start/End: Original strand, 988261 - 988518
Alignment:
| Q |
55 |
tatctattccatattcctatctt---ctattcatcgcgttgtgctgagccaatttgagtgccacacaacacaatgctactatccatggctatggttatgt |
151 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
988261 |
tatctattccatattcctatcttcttctattcatcgcgttgtgctgagccaatttgagtgccacacaacacaatgctactatccatggctatggctatgt |
988360 |
T |
 |
| Q |
152 |
catctctacctcacaacctcacctttctaccttcacatctttctccactatcttcttcaatttctactactaaatctcttcgaaacacttctttattcaa |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
988361 |
catctctacctcacaacctcacctttctaccttcacatctttctccactatcttcttcaatttctactactaaatctcttcgaaacacttctttattcaa |
988460 |
T |
 |
| Q |
252 |
aatcaaatgcattaaaactgaaagagaagcttcttcatcagacccaaatcgaggtttc |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
988461 |
aatcaaatgcattaaaactgaaagagaagcttcttcatcagacccaaatcgaggtttc |
988518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University