View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17496_high_36 (Length: 251)
Name: NF17496_high_36
Description: NF17496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17496_high_36 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 57 - 180
Target Start/End: Original strand, 10788156 - 10788279
Alignment:
| Q |
57 |
tttctttaaagcttgtgaaatatgtgtaccgatattgtatgtgattattctgagtgtcggacgtggagtatatgatttcaatttagtcactttctgttgg |
156 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
10788156 |
tttctttaaagcttgtgaaatatgtgtgccgatattgtatgtgattattctgagtgtcggacgtagagtatatgatttcaatttagtcactttctgttgg |
10788255 |
T |
|
| Q |
157 |
tatttaagtgaaaataatagtttc |
180 |
Q |
| |
|
||||||||| |||||||||||||| |
|
|
| T |
10788256 |
tatttaagtcaaaataatagtttc |
10788279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 199 - 233
Target Start/End: Original strand, 10788282 - 10788316
Alignment:
| Q |
199 |
tttaatctttgtcagcaaaaataatgagtttaatg |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
10788282 |
tttaatctttgtcagcaaaaataatgagtttaatg |
10788316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University