View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17496_high_51 (Length: 205)
Name: NF17496_high_51
Description: NF17496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17496_high_51 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 146; Significance: 4e-77; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 1 - 150
Target Start/End: Complemental strand, 394687 - 394538
Alignment:
| Q |
1 |
tcgtagctatggtgatagtatgttgctgtagatgattttggttccggaaggagttccttcagagcctccatggttttatgaacagtggaggacggtgggg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
394687 |
tcgtagctatggtgatagtatgttgctgtagatgattttggttccggaaggagttccttcagagcctccatggttttatgaacagtggaggacggtgggg |
394588 |
T |
|
| Q |
101 |
tggggtacggcagcgcaggaggaagacgtttggtgtgtttctactttcta |
150 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
394587 |
tgaggtacggcagcgcaggaggaagacgtttggtgtgtttctactttcta |
394538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 1 - 75
Target Start/End: Original strand, 11456130 - 11456204
Alignment:
| Q |
1 |
tcgtagctatggtgatagtatgttgctgtagatgattttggttccggaaggagttccttcagagcctccatggtt |
75 |
Q |
| |
|
|||| |||||| | ||||||||||| ||| |||||||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
11456130 |
tcgttgctatgatcatagtatgttgttgtggatgattttggttctggaaggagttccttcagagccgccatggtt |
11456204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University