View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17496_low_23 (Length: 305)
Name: NF17496_low_23
Description: NF17496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17496_low_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 57 - 267
Target Start/End: Complemental strand, 29909488 - 29909278
Alignment:
| Q |
57 |
atccatactcttatcaagacgtgnnnnnnnngtccactgtagatttagaaatttggtggattgacttttgtgccaatttaattatggaattttcgcggtt |
156 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
29909488 |
atccatactcttatcaagacgtgaaaaaaaagtccactgtagatttagaaatttggtggattgacttttgtgccaatttaattctggaattttcgcggtt |
29909389 |
T |
 |
| Q |
157 |
gttttcccctttctgaatttgaattttgtggtggtttgatgtgagggccgtttacctctcaatagtttatctggtttctcaaaggtcaagggatgtcgtt |
256 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29909388 |
gttttcccctttctaaatttgaattttgtggcggtttgatgtgagggccgtttacctctcaatagtttatctggtttctcaaaggtcaagggatgtcgtt |
29909289 |
T |
 |
| Q |
257 |
gtcaacgaatt |
267 |
Q |
| |
|
||||||||||| |
|
|
| T |
29909288 |
gtcaacgaatt |
29909278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 10 - 58
Target Start/End: Complemental strand, 23259480 - 23259432
Alignment:
| Q |
10 |
ataattcttgtttgatcttgtttttgtgataaagttaaaagaacattat |
58 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
23259480 |
ataattcttgtttgattttgtttttgtgataaagttaaaagaacattat |
23259432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University