View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17496_low_38 (Length: 251)
Name: NF17496_low_38
Description: NF17496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17496_low_38 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 104; Significance: 6e-52; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 8 - 115
Target Start/End: Original strand, 41845415 - 41845522
Alignment:
| Q |
8 |
ccaagaatattactagatcccccacttgaatcagcaataatgacagaagaaatctttggccctgtgcttcccataataactgtaagatatatatctgcaa |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41845415 |
ccaacaatattactagatcccccacttgaatcagcaataatgacagaagaaatctttggccctgtgcttcccataataactgtaagatatatatctgcaa |
41845514 |
T |
 |
| Q |
108 |
cataattt |
115 |
Q |
| |
|
|||||||| |
|
|
| T |
41845515 |
cataattt |
41845522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 183 - 251
Target Start/End: Original strand, 41845589 - 41845657
Alignment:
| Q |
183 |
gcaggtggggaagattgaagacggtattgagttcataaactcaaagcctaaacctctagcaatttatgc |
251 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41845589 |
gcaggtggagaagattgaagacggtattgagttcataaactcaaagcctaaacctctagcaatttatgc |
41845657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University