View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17496_low_4 (Length: 491)
Name: NF17496_low_4
Description: NF17496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17496_low_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 350; Significance: 0; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 350; E-Value: 0
Query Start/End: Original strand, 18 - 403
Target Start/End: Original strand, 26968749 - 26969134
Alignment:
| Q |
18 |
cccacatcattgaatgtctgaccggtcatctgatccgccgctttcagcctctccgccaccgctcctgttcgagtatcctccgttctgatcaccccctcat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26968749 |
cccacatcattgaatgtctgaccggtcatctgatccgccgctttcagcctctccgccaccgctcctgttcgagtatcctccgttctgatcaccccctcat |
26968848 |
T |
|
| Q |
118 |
ttccacgcctccaagtttcctctccaaatcctttacgtccataatttccactttccattttcctccctgcttctttatctgcttcactcaacatttcctg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26968849 |
ttccacgcctccaagtttcctctccaaatcctttacgtccataatttccactttccattttcctccctgcttctttatctgcttcactcaacatttcctg |
26968948 |
T |
|
| Q |
218 |
cattatccatgccaaaattccacaaccactgatcaataaatatctcaaacatcaaaaacatatactaccataaattcaaatttgttaccttggtcttgtc |
317 |
Q |
| |
|
|||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26968949 |
cattatccatgcaaaaattccacaaccactaatcaataaatatctcaaacatcaaaaacatatactaccataaattcaaatttgttaccttggtcttgtc |
26969048 |
T |
|
| Q |
318 |
ttttgcctctactgtcttttgcttagcagcctcagtggtttctgcagttttctgtttagcagcttccgctgtctctgcagttttct |
403 |
Q |
| |
|
||||||||||||||||||||| |||||||| || | || |||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
26969049 |
ttttgcctctactgtcttttgtttagcagcttctgctgtctctgcagttttctgtttagcagcttctgctgtctctgcagttttct |
26969134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 108; E-Value: 5e-54
Query Start/End: Original strand, 358 - 481
Target Start/End: Original strand, 26969122 - 26969245
Alignment:
| Q |
358 |
tctgcagttttctgtttagcagcttccgctgtctctgcagttttctccttagcttcctctttcttgtcacccaagtaacccatagcccgtttcgccgcat |
457 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26969122 |
tctgcagttttctgtttagcagcttctgctgtctctgcagttttctgtttagcttcctctttcttgtcacccaagtaacccatagcccgtttcgccgcat |
26969221 |
T |
|
| Q |
458 |
caacagcagagtctttcatctcac |
481 |
Q |
| |
|
||||||||||||| |||||||||| |
|
|
| T |
26969222 |
caacagcagagtccttcatctcac |
26969245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University