View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17496_low_43 (Length: 238)
Name: NF17496_low_43
Description: NF17496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17496_low_43 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 20 - 216
Target Start/End: Original strand, 1905819 - 1906021
Alignment:
| Q |
20 |
caccacggccacgggttatgaaacgtgagtttcctatgatccaataggattttgatttcttccttaaaattgattttgctg-agtcc-----aactttga |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| | | ||| ||||| || |
|
|
| T |
1905819 |
caccacggccacgggttatgaaacgtgagtttcctatgatccaatagaattttgatttcttccttaaaattgattttgatttattcctatgaaacttgga |
1905918 |
T |
|
| Q |
114 |
ctatatgtgatgaaagtttgaaaattgtgttttacatcaaatttgttttatgtaaaaacatcctaacatgaatgactttatttcagtcatttttaaccaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1905919 |
ctatatgtgatgaaagtttgaaaattgtgttttacatcaaatttgttttatgtaaaaacatcctaacatgaatgactttatttcagtcatttttaaccaa |
1906018 |
T |
|
| Q |
214 |
att |
216 |
Q |
| |
|
||| |
|
|
| T |
1906019 |
att |
1906021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University