View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17496_low_46 (Length: 229)
Name: NF17496_low_46
Description: NF17496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17496_low_46 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 35794764 - 35794967
Alignment:
| Q |
1 |
gagataacaataattcttagcatcaattaataataataatcctttttgtggggacaaatattggagcactagttgtggttcactaaatgagaatatttat |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35794764 |
gagataacaataattcttaacatcaattaataataataatcctttttgtggggacaaatattggagcactagttgtggttcactaaatgagaatatttat |
35794863 |
T |
 |
| Q |
101 |
agtataaattggcataaaaagaagtgaagttatggtcatcaattatatataccattagtacctttgttccatgagaagttattaaatttaaggccttgtc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35794864 |
agtataaattggcataaaaagaagtgaagttgtggtcatcaattatata---------tacctttgttccatgagaagttattaaatttaaggccttgtc |
35794954 |
T |
 |
| Q |
201 |
catcattattatt |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
35794955 |
catcattattatt |
35794967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University