View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17496_low_47 (Length: 229)
Name: NF17496_low_47
Description: NF17496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17496_low_47 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 52591344 - 52591555
Alignment:
| Q |
1 |
acccccagcaaccatgtccaaagaggacaccacaatttgcatccgatggcagtactgtctgtatctcttgtctacctataaccagcacaaagaaaggatt |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52591344 |
acccccagcaaccatgtccaaagatgacaccacaatttgcatccgatggcagtactgtctgtatctcttgtctacctataaccagcacaaagaaaggatt |
52591443 |
T |
 |
| Q |
101 |
acagattcgacaatcagccaaaccatcactgtcataataactaactatggaatagaagaagaaaataattctgacacacttacagtataaaacattttga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52591444 |
acagattcgacaatcagccaaaccatcactgtcataataactaactatggaatagaagaagagaataattctgacacacttacagtataaaacattttga |
52591543 |
T |
 |
| Q |
201 |
cacacttttagt |
212 |
Q |
| |
|
|||||||||||| |
|
|
| T |
52591544 |
cacacttttagt |
52591555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 5 - 74
Target Start/End: Original strand, 7302435 - 7302504
Alignment:
| Q |
5 |
ccagcaaccatgtccaaagaggacaccacaatttgcatccgatggcagtactgtctgtatctcttgtcta |
74 |
Q |
| |
|
|||||||||||||| ||||| ||||| ||||| ||||| |||| ||||| |||| |||||| ||||||| |
|
|
| T |
7302435 |
ccagcaaccatgtcaaaagatgacacaacaatctgcatttgatgacagtattgtcggtatcttttgtcta |
7302504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University