View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17498_high_11 (Length: 289)
Name: NF17498_high_11
Description: NF17498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17498_high_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 21 - 283
Target Start/End: Complemental strand, 36222633 - 36222370
Alignment:
| Q |
21 |
ctagccatcaaattctattggtggcttgaccctcttggggctatcttggtaggttcttcagttcatatacacattcaacttttttcaccatnnnnnnn-t |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
36222633 |
ctagccatcaaattctattggtggcttgaccctcttggggctatcttggtaggttcttcagttcatatacacattcaacttttttcaccataaaaaaaat |
36222534 |
T |
 |
| Q |
120 |
ggcatatcttagtttagttgcttttatttcttcccacttcacaactaatactgcaaagacaaaattaaatcaagttcatcatatttcagcaacatagtca |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36222533 |
ggcatatcttagtttagttgcttttatttcttcctacttcacaactaatactgcaaagacaaaattaaatcaagttcatcatatttcagcaacatagtca |
36222434 |
T |
 |
| Q |
220 |
tagtaggtttttgatgtttgaattggttctcggaatttcaaatgtcattcaaaatgagctctct |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36222433 |
tagtaggtttttgatgtttgaattggttctcggaatttcaaatgtcattcaaaatgagctctct |
36222370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University