View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17498_high_17 (Length: 216)
Name: NF17498_high_17
Description: NF17498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17498_high_17 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 19 - 206
Target Start/End: Complemental strand, 3140396 - 3140209
Alignment:
| Q |
19 |
ccaaagatttaccagacgctcaagcatgctttttgtgaaatagccagaaaatcctgcaggtgttgctggtggaaagtcttctgcaggcatggcgaacggg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3140396 |
ccaaagatttaccagacgctcaagcatgctttttgtgaaatagccagaaaatcctgcaggtgttgctggtggaaagtcttctgcaggcatggcgaacggg |
3140297 |
T |
 |
| Q |
119 |
cgaatcattttctccatagtttctaacgtgagatatgaacctacttcttgtagcctctctggacccataataggcagtctgtgctcct |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
3140296 |
cgaatcattttctccatagtttctaacgtgagatatgaacctacttcttgtagcctctctggacccataataggcagtgtgtgctcct |
3140209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 19 - 206
Target Start/End: Complemental strand, 1933633 - 1933443
Alignment:
| Q |
19 |
ccaaagatttaccagacgctcaagcatgctttttgtgaaatagccagaaaatcctgcaggtgttgctggtgga---aagtcttctgcaggcatggcgaac |
115 |
Q |
| |
|
|||||||||||| |||||||| || | |||||||| ||||||||| || |||||||| ||||||||||||||| ||||||||||||||||| || || |
|
|
| T |
1933633 |
ccaaagatttactagacgctcgagtacgctttttgagaaatagccggagaatcctgctggtgttgctggtggagggaagtcttctgcaggcatagcaaat |
1933534 |
T |
 |
| Q |
116 |
gggcgaatcattttctccatagtttctaacgtgagatatgaacctacttcttgtagcctctctggacccataataggcagtctgtgctcct |
206 |
Q |
| |
|
|| | || ||| ||||||| |||||||||||||| ||||||| | |||||||||||| || |||||||||||||| ||| |||| |||| |
|
|
| T |
1933533 |
ggacaaaacatcatctccattttttctaacgtgagacatgaaccaatttcttgtagcctttcaggacccataataggaagtgtgtgttcct |
1933443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University