View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17498_low_14 (Length: 265)
Name: NF17498_low_14
Description: NF17498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17498_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 113; Significance: 3e-57; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 139 - 255
Target Start/End: Original strand, 43094182 - 43094298
Alignment:
| Q |
139 |
agttcttcattcacattctcattccaactattagtatcccaacctttgctatctccatcaacatcaaccctttcttcaccctcaacaaattcttcatttt |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43094182 |
agttcttcattcacattctcattccaactattagtatcccaacctttgctatctccatcaacatcaaccctttcttcaccctcaacaaattcttcatttt |
43094281 |
T |
|
| Q |
239 |
cacccttcacaggttct |
255 |
Q |
| |
|
|||||||||||| |||| |
|
|
| T |
43094282 |
cacccttcacagattct |
43094298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University