View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17498_low_5 (Length: 377)
Name: NF17498_low_5
Description: NF17498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17498_low_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 326; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 326; E-Value: 0
Query Start/End: Original strand, 19 - 360
Target Start/End: Complemental strand, 12356092 - 12355751
Alignment:
| Q |
19 |
atttgattttcaaatttcgaaagtgcgtaaatatttaagtgatattttatctcgtatctgagattagattgagtcctatgttttcaatgaccctcacttc |
118 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12356092 |
atttgatttgcaaatttcgaaagtgcgtaaatatttaagtgatgttttatctcgtatctgagattagattgagtcctatgttttcaatgaccctcacttc |
12355993 |
T |
 |
| Q |
119 |
agcctagtttgtgattttatcaagattgaaagttcgtgatttctgactctttctttgggtacaaaaattgcacagtggaggtgatgtttcaaatgttttc |
218 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12355992 |
agcctagtttgtgattttctcaagattgaaagttcgtgatttctgactctttctttgggtacaaaaattgcacagtggaggtgatgtttcaaatgttttc |
12355893 |
T |
 |
| Q |
219 |
ttccctgtgaaaaattcaaggagggaaaatgatttagattcagatgaggtagcttaatcattttagatttagagtccaatttagttctttcattggcaaa |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
12355892 |
ttccctgtgaaaaattcaaggagggaaaatgatttagattcagatgaggtagcttaatcattttagatttagagtccaatttggttctttcattggcaaa |
12355793 |
T |
 |
| Q |
319 |
actttattaatacaaagagatgtttactgcaactgaaaatac |
360 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12355792 |
actttattaatacaaagagatgtttactgcaactgaaaatac |
12355751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University