View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17499_high_16 (Length: 226)
Name: NF17499_high_16
Description: NF17499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17499_high_16 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 137 - 212
Target Start/End: Original strand, 6458979 - 6459054
Alignment:
| Q |
137 |
tctttatgagttatgcatttcacaacaaaaacatgaaattgtttagcatattataaggtaacttgtttgaagaaag |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6458979 |
tctttatgagttatgcatttcacaacaaaaacatgaaattgtttagcatattataaggtaacttgtttgaagaaag |
6459054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 16 - 54
Target Start/End: Original strand, 6458859 - 6458896
Alignment:
| Q |
16 |
tgaatagaaatagaaaggttggttactgtgttttatatt |
54 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
6458859 |
tgaatagaaatagaaaggttggttactg-gttttatatt |
6458896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University