View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17499_low_14 (Length: 271)
Name: NF17499_low_14
Description: NF17499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17499_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 69; Significance: 5e-31; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 1 - 69
Target Start/End: Complemental strand, 40800173 - 40800105
Alignment:
| Q |
1 |
ccacttcatacaataccttgatgcaacaaccaagtagaagtcatgcagcactgacacttgacgtgtccg |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40800173 |
ccacttcatacaataccttgatgcaacaaccaagtagaagtcatgcagcactgacacttgacgtgtccg |
40800105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 142 - 188
Target Start/End: Complemental strand, 40800025 - 40799979
Alignment:
| Q |
142 |
agtgtttcgtagagtagtagacattaatcatatccatcatcacatgc |
188 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40800025 |
agtgtttcgtagagtagtagacattgatcatatccatcatcacatgc |
40799979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University