View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17499_low_18 (Length: 235)
Name: NF17499_low_18
Description: NF17499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17499_low_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 30782492 - 30782711
Alignment:
| Q |
1 |
tttttatttattgggaattctatttatgctctctactagcgagttatgtccagatttgtggtagagagtccttatacctgcaacaaaacgtgtcttgtta |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30782492 |
tttttatttattgggaattctttttatgctctctactagcgagttatgtccagatttgtggtagagagtccttatacctgcaacaaaacgtgtcttgtta |
30782591 |
T |
|
| Q |
101 |
tttattgcaataatggttttgatgctctctattagcgagttatgtccagatttgacactataaagaccttaatttcgataaaacttataaagaccttgac |
200 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30782592 |
tttattgcaataatggtttttatgctctctattagcgagttatgtccagatttgacactataaagaccttaatttcgataaaacttataaagaccttgac |
30782691 |
T |
|
| Q |
201 |
actataaataatgttgttaa |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
30782692 |
actataaataatgttgttaa |
30782711 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 95 - 220
Target Start/End: Original strand, 30245591 - 30245714
Alignment:
| Q |
95 |
ttgttatttattgcaataatggttttgatgctctctattagcgagttatgtccagatttgacactataaagaccttaatttcgataaaacttataaagac |
194 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||| |||||| || |
|
|
| T |
30245591 |
ttgttgtttattgcaa--atggttttgatgctctctattagcgagttatgtccagatttgacactataaagactataattttgataaaacctataaacac |
30245688 |
T |
|
| Q |
195 |
cttgacactataaataatgttgttaa |
220 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
30245689 |
cttgacactataaataatgttgttaa |
30245714 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 26 - 58
Target Start/End: Original strand, 30245616 - 30245648
Alignment:
| Q |
26 |
atgctctctactagcgagttatgtccagatttg |
58 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
30245616 |
atgctctctattagcgagttatgtccagatttg |
30245648 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University