View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17499_low_21 (Length: 225)
Name: NF17499_low_21
Description: NF17499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17499_low_21 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 7 - 225
Target Start/End: Original strand, 45035257 - 45035471
Alignment:
| Q |
7 |
acatcatcacaaatagatttaggattatctcaagattacatcgcataattcggaaaactcataatacaactttgagctagagtgatttggtcggccatag |
106 |
Q |
| |
|
|||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45035257 |
acatcatcacaaatagatttaggattatttgaagattacatcgcataattcggaaaactcataatacaactttgagctagagtgatttggtcggccata- |
45035355 |
T |
 |
| Q |
107 |
aaagtgagttaactttccaccc-aaaattttactcttgattgatatagagaatctgataataccagggatcgaatcttggactacacatttgtatccgca |
205 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45035356 |
----tgagttaactttccacccaaaaattttactcttgattgatatagagaatccgataataccagggatcgaatcttggactacacatttgtatccgca |
45035451 |
T |
 |
| Q |
206 |
cagaacacaattgttaatac |
225 |
Q |
| |
|
|| ||||||||||||||||| |
|
|
| T |
45035452 |
cataacacaattgttaatac |
45035471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University