View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1749_low_10 (Length: 218)
Name: NF1749_low_10
Description: NF1749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1749_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 55 - 207
Target Start/End: Complemental strand, 49705049 - 49704897
Alignment:
| Q |
55 |
ttgtgtattgagtttgatcttcctattgcacttccaaaaagtatatggtcagatagtaatggtacattgtttatctcttttacgttatgtttgtctttct |
154 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49705049 |
ttgtgtattgagcttgatcttcctattgcacttccaaaacgtatatggtcagatagtaatggtacattgtttatctcttttacgttatgtttgtctttct |
49704950 |
T |
|
| Q |
155 |
tcacacgtaaactttgggaaatcaaatatgtattgtatactactcgatatagt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49704949 |
tcacacgtaaactttgggaaatcaaatatgtattgtatactactcgatatagt |
49704897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University