View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1749_low_6 (Length: 283)
Name: NF1749_low_6
Description: NF1749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1749_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 3 - 268
Target Start/End: Complemental strand, 43494705 - 43494440
Alignment:
| Q |
3 |
caaaggaattggatttgagatatgcaagcaattggcttctataggaattacagtgattgtaacagcaagagatgagtgtaggggtcttcaagcttttgat |
102 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43494705 |
caaaggaattggatttgagatatgcaatcaattggcttctataggaattacagtgattgtaacagcaagagatgagtgtaggggtcttcaagcttttgat |
43494606 |
T |
|
| Q |
103 |
aaactcaaacaagagtttgaccttgccatgtctcacagtgacaatgtgattttccatcaccttgatgtggttgaccctaaaagcatatcatctcttgcaa |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43494605 |
aaactcaaacaagagtttgaccttgccatgtctcacagtgacaaagtgattttccatcaccttgatgtggttgaccctaaaagcatatcatctcttgcaa |
43494506 |
T |
|
| Q |
203 |
atttcatcaaaattcattttgaaaaacttgatatcttggtatggtttcattaactaacactcacat |
268 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43494505 |
atttcatcaaaattcattttggaaaacttgatatcttggtatggtttcattaactaacactcacat |
43494440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University