View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17502_high_20 (Length: 249)

Name: NF17502_high_20
Description: NF17502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17502_high_20
NF17502_high_20
[»] chr3 (1 HSPs)
chr3 (1-189)||(44501548-44501736)


Alignment Details
Target: chr3 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 189
Target Start/End: Complemental strand, 44501736 - 44501548
Alignment:
1 aaatttagaactctttctttcttatttgcccttttaaacactgctatgattggatatttgaatagcttttagttttgtttagggaattgatatgataccg 100  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44501736 aaatttagaaatctttctttcttatttgcccttttaaacactgctatgattggatatttgaatagcttttagttttgtttagggaattgatatgataccg 44501637  T
101 ctctgtaatttttactgccagagagagggaaagttgaaaaaatgaatagtactatgcttggagacaaatcttcataagcagagaaaaca 189  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||    
44501636 ctctgtaatttttactgccagagagagggaaagttgaaaaaaggaatagtactatggttggagacaaatcttcataagcagagaaaaca 44501548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University