View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17502_high_23 (Length: 248)
Name: NF17502_high_23
Description: NF17502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17502_high_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 27455728 - 27455522
Alignment:
| Q |
1 |
tagaggcttttttcttctatatacattattggactatgtgatatagatttaagtttatgggtattcgactatctgacaattgaaaactatatgagttttg |
100 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||| ||||||| ||| |
|
|
| T |
27455728 |
tagaggtttttttcttctatatacattattggactatgtgatatagatttaagtttatgggtatttgactatgtgacaattgaaaac--tatgagtattg |
27455631 |
T |
 |
| Q |
101 |
aactatgtgacataaatttaattagtgnnnnnnnatgttgcggcttgatttgatttagtttggttggtaaaatgaaaactttaaattagaccgaaccgtg |
200 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||| | |||||||| ||||||| |||||||||||||||||| | ||| |||| ||||| ||| |
|
|
| T |
27455630 |
gactatatgacataaatttaattagtgttttcttatgttgcagtttgatttggtttagttcggttggtaaaatgaaaacctcaaactagatcgaactgtg |
27455531 |
T |
 |
| Q |
201 |
gggttgagt |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
27455530 |
gggttgagt |
27455522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 135 - 180
Target Start/End: Complemental strand, 8117901 - 8117856
Alignment:
| Q |
135 |
atgttgcggcttgatttgatttagtttggttggtaaaatgaaaact |
180 |
Q |
| |
|
||||||||| |||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
8117901 |
atgttgcggtttgatttggtttggtttggttggtaaaatgaaaact |
8117856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 135 - 197
Target Start/End: Original strand, 18845979 - 18846041
Alignment:
| Q |
135 |
atgttgcggcttgatttgatttagtttggttggtaaaatgaaaactttaaattagaccgaacc |
197 |
Q |
| |
|
||||||||| |||||||| ||| |||||||||||||||| ||||| ||||||| ||| |||| |
|
|
| T |
18845979 |
atgttgcggtttgatttggttttgtttggttggtaaaataaaaaccgtaaattaaaccaaacc |
18846041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University